| Internal ID | 17656608 | Source Database | TransTermHP TERM 39 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 39
|
| Sequence |
CGCGGCGGCTCAGGCCGCCGCG Look for more occurrences |
| Start | 214631 |
| End | 214652 |
| Strand | + |
| Genomic Context | Located within gene [PA14_02390] |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGGAAGGGAAACCG(5' tail) CGCGGCGGC(5' stem) TCAG(loop) GCCGCCGCG(3' stem) TGTTGCGCCTGGTCC(3' tail). Confidence: 91. opp_overlap 214629 214628 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|