Internal ID | 17654200 | Source Database | TransTermHP TERM 987 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 987
|
Sequence |
CCCCCGGCCTGAAAAACCGGGGG Look for more occurrences |
Start | 5014579 |
End | 5014601 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCGGCAAAGAAAAA(5' tail) CCCCCGG(5' stem) TTTTTCAGG(loop) CCGGGGG(3' stem) TTCGTTCGTCACTCG(3' tail). Confidence: 100. opp_overlap 5014579, overlap 5014573 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|