Internal ID | 17654568 | Source Database | TransTermHP TERM 19 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 19
|
Sequence |
CGGCGACCTTCGGGTCGCCG Look for more occurrences |
Start | 80396 |
End | 80415 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCCCCTCAACGAAA(5' tail) CGGCGACC(5' stem) CGAA(loop) GGTCGCCG(3' stem) TCGCGTTCGTGCCGG(3' tail). Confidence: 93. opp_overlap 80391 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|