| Internal ID | 17657025 | Source Database | TransTermHP TERM 706 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 706
|
| Sequence |
AAGCCCCGGCCTTGCCGGGGCTA Look for more occurrences |
| Start | 2864546 |
| End | 2864568 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CACGTCAGCATTGAA(5' tail) AAGCCCCGGC(5' stem) CTT(loop) GCCGGGGCTA(3' stem) TTTATTTCACTCTGC(3' tail). Confidence: 100. opp_overlap 2864548, overlap 2864548 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|