Internal ID | 17658831 | Source Database | TransTermHP TERM 626 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 626
|
Sequence |
GGCCCGGCTCACTCAGTGACCGGGCC Look for more occurrences |
Start | 2599149 |
End | 2599174 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae pv. tomato str. DC3000 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CACCCATAGCAAAAA(5' tail) GGCCCGG-TCAC(5' stem) TGA(loop) GTGAGCCGGGCC(3' stem) TTTCTGATGCCGTCA(3' tail). Confidence: 100. gap 1, opp_overlap 2599149 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|