| Internal ID | 17659857 | Source Database | TransTermHP TERM 766 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 766
|
| Sequence |
GGGCCCGGACTGACCGGGCCC Look for more occurrences |
| Start | 3299885 |
| End | 3299905 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. syringae B728a chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAACTCACTGCGAAT(5' tail) GGGCCCGG(5' stem) ACTGA(loop) CCGGGCCC(3' stem) TTTCGGACACTCAGC(3' tail). Confidence: 95. opp_overlap 3299877 3299873 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|