Motif View

Internal ID 17662894
Source Database TransTermHP TERM 952
Feature Type terminator
Name
Rho-independent transcription terminator TERM 952
Sequence CGGGGGCCTGGTCGCCCCCG
Look for more occurrences
Start 4472760
End 4472779
Strand -
Genomic Context
Replicon Pseudomonas aeruginosa PA7 chromosome, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments AGCCATGGACGAAAA(5' tail) CGGGGGC(5' stem) GACCAG(loop) GCCCCCG(3' stem) TTTTCCTGCGTACCT(3' tail). Confidence: 91. opp_overlap 4472760

Reference

Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685