Internal ID | 17669075 | Source Database | TransTermHP TERM 335 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 335
|
Sequence |
GGCGCTGATGACATCATCGGCGCC Look for more occurrences |
Start | 1277425 |
End | 1277448 |
Strand | + |
Genomic Context | Located within gene [PSEBR_a1006] |
Replicon | Pseudomonas brassicacearum subsp. brassicacearum NFM421 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CAGTGTCTCCAGGAT(5' tail) GGCGCTGATG(5' stem) ACAT(loop) CATCGGCGCC(3' stem) TTCTGCACCGATGGC(3' tail). Confidence: 95. opp_overlap 1277438 1277441, overlap 1277436 1277444 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|