Motif View

Internal ID 17670213
Source Database TransTermHP TERM 474
Feature Type terminator
Name
Rho-independent transcription terminator TERM 474
Sequence CCAGAAGCCCGCCATTACGCGGGCTTCTGC
Look for more occurrences
Start 1500304
End 1500333
Strand -
Genomic Context
Replicon Pseudomonas fulva 12-X chromosome, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments TCTTTTCATAACAAA(5' tail) GCAGAAGCCCGC(5' stem) GTAATG(loop) GCGGGCTTCTGG(3' stem) GGTTCTGGGAAGATC(3' tail). Confidence: 95. opp_overlap 1500303 1500310, overlap 1500305

Reference

Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685