| Internal ID | 17670459 | Source Database | TransTermHP TERM 857 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 857
|
| Sequence |
GAAGGCCCATAAAGGGCCTTC Look for more occurrences |
| Start | 2810472 |
| End | 2810492 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fulva 12-X chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCCGCGTAAAACAA(5' tail) GAAGGCCC(5' stem) TTTAT(loop) GGGCCTTC(3' stem) TTGCATTTCCAGGGG(3' tail). Confidence: 93. opp_overlap 2810468 2810467 2810472 2810475, overlap 2810469 2810475 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|