| Internal ID | 17671630 | Source Database | TransTermHP TERM 1103 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1103
|
| Sequence |
GGCCGCTGCCCATGCAGCGGCC Look for more occurrences |
| Start | 4139709 |
| End | 4139730 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTCAGAAAATGCAAA(5' tail) GGCCGCTGC(5' stem) ATGG(loop) GCAGCGGCC(3' stem) AAGATGTTTCATGCT(3' tail). Confidence: 100. opp_overlap 4139706 4139705 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|