| Internal ID | 17671817 | Source Database | TransTermHP TERM 1404 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1404
|
| Sequence |
CCCCAGATCGCACGCGCGGTCTGGGG Look for more occurrences |
| Start | 5204152 |
| End | 5204177 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCACAAAGAAGAAA(5' tail) CCCCAGACCGC(5' stem) GCGT(loop) GCGATCTGGGG(3' stem) TTTCGTATAGGAGCT(3' tail). Confidence: 100. opp_overlap 5204152, overlap 5204148 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|