| Internal ID | 17675089 | Source Database | TransTermHP TERM 317 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 317
|
| Sequence |
CTGGGGCCGCTTGGCGGCCCCGG Look for more occurrences |
| Start | 1327112 |
| End | 1327134 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida BIRD-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGGCGCCCTGAGCAA(5' tail) CCGGGGCCGC(5' stem) CAA(loop) GCGGCCCCAG(3' stem) CCATCGATCAAAGCT(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|