| Internal ID | 17675679 | Source Database | TransTermHP TERM 111 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 111
|
| Sequence |
GGCGGCCGGCACCCGTGCCGGCCGCC Look for more occurrences |
| Start | 497648 |
| End | 497673 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa M18 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGAGCGGCGCGACG(5' tail) GGCGGCCGGCA(5' stem) CCCG(loop) TGCCGGCCGCC(3' stem) GTGTTTCAGAACAGC(3' tail). Confidence: 100. overlap 497647 497646 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|