Internal ID | 17679448 | Source Database | TransTermHP TERM 909 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 909
|
Sequence |
CGGGCGGCTCAGGCCGCCCG Look for more occurrences |
Start | 4127636 |
End | 4127655 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas stutzeri CCUG 29243 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCCCACAAATGAAAA(5' tail) CGGGCGGC(5' stem) CTGA(loop) GCCGCCCG(3' stem) TCGCGATACCGCCAG(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|