| Internal ID | 17679703 | Source Database | TransTermHP TERM 306 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 306
|
| Sequence |
GCCGGGGCCTTGTGCCCCGGC Look for more occurrences |
| Start | 1458312 |
| End | 1458332 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri DSM 10701 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTTCCACGGAAGGAA(5' tail) GCCGGGGC(5' stem) CTTGT(loop) GCCCCGGC(3' stem) TTTCGTTTCAGGGCC(3' tail). Confidence: 100. opp_overlap 1458308 1458312, overlap 1458308 1458293 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|