Internal ID | 17685169 | Source Database | TransTermHP TERM 636 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 636
|
Sequence |
GGCCCGCATAGCTGCGGGCC Look for more occurrences |
Start | 3090738 |
End | 3090757 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas stutzeri RCH2 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCGGAAACAAAAAA(5' tail) GGCCCGCA(5' stem) TAGC(loop) TGCGGGCC(3' stem) TTTGATTTCATTGGT(3' tail). Confidence: 100. opp_overlap 3090738 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|