| Internal ID | 17685170 | Source Database | TransTermHP TERM 637 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 637
|
| Sequence |
GGGTTAGCTTCGGCTAGCCC Look for more occurrences |
| Start | 3098957 |
| End | 3098976 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri RCH2 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCCCAAAAACAAAA(5' tail) GGGCTAGC(5' stem) CGAA(loop) GCTAACCC(3' stem) TTTGATTTCATTGGT(3' tail). Confidence: 100. opp_overlap 3098957, overlap 3098940 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|