| Internal ID | 17685901 | Source Database | TransTermHP TERM 663 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 663
|
| Sequence |
GGGGCGACCAACACGGTCGCCCC Look for more occurrences |
| Start | 2965092 |
| End | 2965114 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCAACAATAAAAAA(5' tail) GGGGCGACC(5' stem) AACAC(loop) GGTCGCCCC(3' stem) TTTTTTGCGATTGCC(3' tail). Confidence: 100. opp_overlap 2965092 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|