| Internal ID | 17685986 | Source Database | TransTermHP TERM 794 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 794
|
| Sequence |
TCCCGCTCGGGTTCGCCGAAGCGGGA Look for more occurrences |
| Start | 3798458 |
| End | 3798483 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAGGCGTAAAAAAA(5' tail) TCCCGCTTCGG(5' stem) CGAAC(loop) CCGA-GCGGGA(3' stem) TTGTTTTGTTCAGGC(3' tail). Confidence: 100. gap 1, opp_overlap 3798458 3798455 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|