| Internal ID | 17686390 | Source Database | TransTermHP TERM 1318 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1318
|
| Sequence |
CCGCTGCTCCTTCGGGACCAGCGG Look for more occurrences |
| Start | 5682997 |
| End | 5683020 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCCCCCAAAAAAAA(5' tail) CCGCTGGTCC(5' stem) CGAA(loop) GGAGCAGCGG(3' stem) CTTTTTCAAGTGCTT(3' tail). Confidence: 100. opp_overlap 5682997 5682996 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|