| Internal ID | 17686757 | Source Database | TransTermHP TERM 370 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 370
|
| Sequence |
GGCGCCCATCCTCGATGGGCGCC Look for more occurrences |
| Start | 1455258 |
| End | 1455280 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTAGCGATAAAAAA(5' tail) GGCGCCCATC(5' stem) GAG(loop) GATGGGCGCC(3' stem) GACAGGTTATTTACC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|