| Internal ID | 17688134 | Source Database | TransTermHP TERM 774 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 774
|
| Sequence |
TGCCCCGAACCAGTCGGGGCA Look for more occurrences |
| Start | 3484904 |
| End | 3484924 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas poae RE*1-1-14, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCACCGCACTGAAAA(5' tail) TGCCCCGA(5' stem) CTGGT(loop) TCGGGGCA(3' stem) TTTTTTTGCGCGCGA(3' tail). Confidence: 95. opp_overlap 3484904 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|