Motif View

Internal ID 17688135
Source Database TransTermHP TERM 775
Feature Type terminator
Name
Rho-independent transcription terminator TERM 775
Sequence TGCCCCGACTGGTTCGGGGCA
Look for more occurrences
Start 3484904
End 3484924
Strand +
Genomic Context
Replicon Pseudomonas poae RE*1-1-14, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments GCACCGCACTGAAAA(5' tail) TGCCCCGA(5' stem) CTGGT(loop) TCGGGGCA(3' stem) TTTTTTTGCGCGCGA(3' tail). Confidence: 100. opp_overlap 3484904

Reference

Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685