Motif View

Internal ID 9649101
Source Database A cross-reference and link to the record at is not available yet.
Feature Type Inverted repeat
Name
Inverted repeat: GGCCTTTTTT-N10-AAAAAAGGCC
Sequence GGCCTTTTTTTACCACGCACAAAAAAGGCC
Look for more occurrences
Start 1424975
End 1425004
Strand +
Genomic Context
Replicon Pseudomonas fluorescens F113 chromosome, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments Software: Palindrome (EMBOSS 6.4.0.0)

Reference

EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A
Trends Genet. 2000 Jun;16(6):276-7
PubMed ID: 10827456