Motif View

Internal ID 9675119
Source Database A cross-reference and link to the record at is not available yet.
Feature Type Inverted repeat
Name
Inverted repeat: GCGTCGCCGAAC-N79-GTTCGGCGACGC
Sequence GCGTCGCCGAACCGGACCCAGTTGGCGACGTCGTTGTGGAAGGTTTCGTAGAGGCGGATCTTCGACTCCAGTTCGTCGATGAAGTCCTGCTGTTCGGCGACGC
Look for more occurrences
Start 86193
End 86295
Strand +
Genomic Context Located within gene [PADK2_00390]
Replicon Pseudomonas aeruginosa DK2 chromosome, complete genome.
Evidence
ECO:0000246
computational combinatorial evidence used in automatic assertion
Additional Comments Software: Palindrome (EMBOSS 6.4.0.0)

Reference

EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A
Trends Genet. 2000 Jun;16(6):276-7
PubMed ID: 10827456