| Internal ID | 1572009 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
PvdS binding site
|
| Sequence |
TAAATTTCATTTCCCTGTCCTCGT Look for more occurrences |
| Start | 2640342 |
| End | 2640365 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
qRT-PCR [RNA],Motif-discovery,DNA-array expression analysis [PMID:22900619] | qRT-PCR [RNA],Motif-discovery,DNA-array expression analysis
|
| Additional Comments |
|
The effect of zinc limitation on the transcriptome of Pseudomonas protegens Pf-5.
Lim CK, Hassan KA, Penesyan A, Loper JE, Paulsen IT
Environ. Microbiol. 2013 Mar;15(3):702-15
PubMed ID: 22900619
|