| Internal ID | 1572019 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
PvdS binding site
|
| Sequence |
TAAATTTAGCCGCCCTGGCCTCGT Look for more occurrences |
| Start | 2642039 |
| End | 2642062 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,Site directed mutagenesis,Northern blot,2D PAGE
|
| Additional Comments |
|
Nitrate-responsive NarX-NarL represses arginine-mediated induction of the Pseudomonas aeruginosa arginine fermentation arcDABC operon.
Benkert B, Quäck N, Schreiber K, Jaensch L, Jahn D, Schobert M
Microbiology (Reading, Engl.) 2008 Oct;154(Pt 10):3053-60
PubMed ID: 18832311
|