| Internal ID | 17655663 | Source Database | TransTermHP TERM 99 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 99
|
| Sequence |
CGCCGACCCTAGGGTCGGCG Look for more occurrences |
| Start | 477814 |
| End | 477833 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCGCCATGCAAGAA(5' tail) CGCCGACC(5' stem) CTAG(loop) GGTCGGCG(3' stem) TTTTTTTATCCTCGC(3' tail). Confidence: 100. opp_overlap 477814 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|