Internal ID | 17656349 | Source Database | TransTermHP TERM 1177 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1177
|
Sequence |
CGGGCCAGCCGGATTGGCTGGCCCG Look for more occurrences |
Start | 5074379 |
End | 5074403 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAGCATTGAACGCAA(5' tail) CGGGCCAGCCA(5' stem) ATC(loop) CGGCTGGCCCG(3' stem) TTCCTTCAGGGGCGC(3' tail). Confidence: 93. opp_overlap 5074379 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|