| Internal ID | 17653978 | Source Database | TransTermHP TERM 596 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 596
|
| Sequence |
GCCCCTGCCGTATCCGCGGCAGGGGC Look for more occurrences |
| Start | 3136905 |
| End | 3136930 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGGAAAGCAGAAA(5' tail) GCCCCTGCCGC(5' stem) GGAT(loop) ACGGCAGGGGC(3' stem) TTTCTTCGCCTGGCG(3' tail). Confidence: 100. opp_overlap 3136905, overlap 3136901 3136898 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|