| Internal ID | 17654294 | Source Database | TransTermHP TERM 1131 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1131
|
| Sequence |
GCCCCACCGGATGGTGGGGC Look for more occurrences |
| Start | 5504370 |
| End | 5504389 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGCGGGCAAAAAAA(5' tail) GCCCCACC(5' stem) ATCC(loop) GGTGGGGC(3' stem) CGAGAGACGAGCGTG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|