| Internal ID | 17655283 | Source Database | TransTermHP TERM 1126 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1126
|
| Sequence |
GCCCCTGCCGCGGATACGGCAGGGGC Look for more occurrences |
| Start | 4509082 |
| End | 4509107 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGGAAAGCAGAAA(5' tail) GCCCCTGCCG(5' stem) CGGATA(loop) CGGCAGGGGC(3' stem) TTTCTTCGCCTGGCG(3' tail). Confidence: 100. opp_overlap 4509078 4509075 4509082 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|