| Internal ID | 17655313 | Source Database | TransTermHP TERM 1188 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1188
|
| Sequence |
GCCCCCGGCCTGGCCGGGGGC Look for more occurrences |
| Start | 4691612 |
| End | 4691632 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGCGATGCCGCAAA(5' tail) GCCCCCGGC(5' stem) CAG(loop) GCCGGGGGC(3' stem) GTCGCGCCAGGGAGC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|