| Internal ID | 17656372 | Source Database | TransTermHP TERM 1208 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1208
|
| Sequence |
CGGGGCTCCCCTGGAGCCCCCG Look for more occurrences |
| Start | 5137374 |
| End | 5137395 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCACAAGGAAAAA(5' tail) CG-GGGCTCC(5' stem) CCT(loop) GGAGCCCCCG(3' stem) TTTTTCCTCTATGGG(3' tail). Confidence: 100. gap 1, opp_overlap 5137359 5137358 5137374, overlap 5137374 5137375 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|