| Internal ID | 17658501 | Source Database | TransTermHP TERM 124 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 124
|
| Sequence |
GAAAGCCCCGCTTAGGCGGGGTTTTC Look for more occurrences |
| Start | 555441 |
| End | 555466 |
| Strand | + |
| Genomic Context | Located within gene [PSPTO_5647] |
| Replicon | Pseudomonas syringae pv. tomato str. DC3000 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGGGAAACAGTCTG(5' tail) GAAAGCCCCGC(5' stem) TTAG(loop) GCGGGGTTTTC(3' stem) TTTGTCTGCGTTTTA(3' tail). Confidence: 100. opp_overlap 555434 555445 555446, overlap 555446 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|