| Internal ID | 17658699 | Source Database | TransTermHP TERM 424 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 424
|
| Sequence |
CAAAACCCGCTGAATGCGGGTTTTG Look for more occurrences |
| Start | 1867670 |
| End | 1867694 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. tomato str. DC3000 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTACGTTCAAAAACA(5' tail) CAAAACCCGC(5' stem) ATTCA(loop) GCGGGTTTTG(3' stem) TCGTTTCTTGTTCTG(3' tail). Confidence: 100. opp_overlap 1867668 1867662 1867670 1867675, overlap 1867668 1867675 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|