| Internal ID | 17659512 | Source Database | TransTermHP TERM 258 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 258
|
| Sequence |
GGCCTGTCTACCTGGTAGACAGGCC Look for more occurrences |
| Start | 1039546 |
| End | 1039570 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. syringae B728a chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGTTTAAAAAGGAAA(5' tail) GGCCTGTCTAC(5' stem) CAG(loop) GTAGACAGGCC(3' stem) TTATTTTGTAACTGC(3' tail). Confidence: 100. opp_overlap 1039543 1039546, overlap 1039541 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|