Internal ID | 17660222 | Source Database | TransTermHP TERM 1305 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1305
|
Sequence |
CGGGCTGGCATGTTCCGGCCCG Look for more occurrences |
Start | 5554811 |
End | 5554832 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae pv. syringae B728a chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GATGACAATTCAAAA(5' tail) CGGGCCGG(5' stem) AACATG(loop) CCAGCCCG(3' stem) TTCAACGGATCAGGC(3' tail). Confidence: 90. overlap 5554823 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|