| Internal ID | 17660590 | Source Database | TransTermHP TERM 408 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 408
|
| Sequence |
GCAGAAGGCGAAGCCCTTCTGC Look for more occurrences |
| Start | 1794853 |
| End | 1794874 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCACGAAAAAAAACA(5' tail) GCAGAAGG(5' stem) GCTTCG(loop) CCTTCTGC(3' stem) GCTGATACTGTTATG(3' tail). Confidence: 95. overlap 1794851 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|