Internal ID | 17661241 | Source Database | TransTermHP TERM 47 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 47
|
Sequence |
TCTCCCCGGCTAGCCGGGGAGA Look for more occurrences |
Start | 204748 |
End | 204769 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas protegens Pf-5 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAAAAGGAATGAAAA(5' tail) TCTCCCCGG(5' stem) CTAG(loop) CCGGGGAGA(3' stem) TTTCTATGTTTCACT(3' tail). Confidence: 100. opp_overlap 204748, overlap 204738 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|