| Internal ID | 17662362 | Source Database | TransTermHP TERM 58 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 58
|
| Sequence |
GCGCCCGGCGCTCGCCGGGCGC Look for more occurrences |
| Start | 336888 |
| End | 336909 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCTCGGGGCAGGGAA(5' tail) GCGCCCGGC(5' stem) GAGC(loop) GCCGGGCGC(3' stem) CGGGACTCAGGCTTC(3' tail). Confidence: 91. opp_overlap 336908 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|