Internal ID | 17662403 | Source Database | TransTermHP TERM 120 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 120
|
Sequence |
GAACGCCGACCCAAGGGTCGGCGTTC Look for more occurrences |
Start | 544185 |
End | 544210 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTCCGCGCCATGCAA(5' tail) GAACGCCGACC(5' stem) CTTG(loop) GGTCGGCGTTC(3' stem) TTTTATCCCTCGCGG(3' tail). Confidence: 91. opp_overlap 544185, overlap 544188 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|