| Internal ID | 17662406 | Source Database | TransTermHP TERM 128 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 128
|
| Sequence |
CCCGGATGGAAACATCCGGG Look for more occurrences |
| Start | 579837 |
| End | 579856 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCCCAGCCCGAAGAA(5' tail) CCCGGATG(5' stem) GAAA(loop) CATCCGGG(3' stem) TTTTTTATTGCCCGC(3' tail). Confidence: 100. opp_overlap 579812 579837 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|