| Internal ID | 17662476 | Source Database | TransTermHP TERM 258 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 258
|
| Sequence |
GAGAGCCCTCCGCCGGAGGGCTTC Look for more occurrences |
| Start | 1181091 |
| End | 1181114 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGGCGCCCTTTTCC(5' tail) GAGAGCCCTCC(5' stem) GCC(loop) GGAGGGCT-TC(3' stem) TTTTTATCCGCTGTG(3' tail). Confidence: 100. gap 1, overlap 1181095 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|