| Internal ID | 17665492 | Source Database | TransTermHP TERM 880 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 880
|
| Sequence |
GGTCGGCCATGTTAAAGTGGCCGGCC Look for more occurrences |
| Start | 4033443 |
| End | 4033468 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri A1501 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGCCTGCAGAAGA(5' tail) GGTCGGCCAT(5' stem) GTTAAA(loop) GTGGCCGGCC(3' stem) TTTTTTCGCCGCTCA(3' tail). Confidence: 100. opp_overlap 4033441 4033443 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|