| Internal ID | 17665508 | Source Database | TransTermHP TERM 904 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 904
|
| Sequence |
TCGGGCTTCCAATTGGAAGCCCGA Look for more occurrences |
| Start | 4231298 |
| End | 4231321 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri A1501 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACTCCCCTAAAAAAA(5' tail) TCGGGCTTCC(5' stem) AATT(loop) GGAAGCCCGA(3' stem) CTTCTACCTCAACCT(3' tail). Confidence: 100. opp_overlap 4231298 4231297 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|