| Internal ID | 17667965 | Source Database | TransTermHP TERM 55 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 55
|
| Sequence |
CCCGTTGCAGGTCACTGCAACGGG Look for more occurrences |
| Start | 173889 |
| End | 173912 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGGGCAATAAAAAA(5' tail) CCCGTTGCAG(5' stem) TGAC(loop) CTGCAACGGG(3' stem) TTTGGGAATTCGCGG(3' tail). Confidence: 100. opp_overlap 173889 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|