| Internal ID | 17667966 | Source Database | TransTermHP TERM 56 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 56
|
| Sequence |
GATGGGGCTGCACAGCAGCCCCTTC Look for more occurrences |
| Start | 174525 |
| End | 174549 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTTACAGCTGAAAAA(5' tail) GAAGGGGCTGC(5' stem) TGT(loop) GCAGCCCCATC(3' stem) GCGACACAAGGCCGC(3' tail). Confidence: 100. overlap 174528 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|