| Internal ID | 17667980 | Source Database | TransTermHP TERM 72 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 72
|
| Sequence |
CCCCTACCTGCATGTGCAGATAGGGG Look for more occurrences |
| Start | 194231 |
| End | 194256 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATTCATTTCGCAAAA(5' tail) CCCCTATCTGC(5' stem) ACAT(loop) GCAGGTAGGGG(3' stem) TTTTGTCTTTAAGTA(3' tail). Confidence: 95. opp_overlap 194231 194226 194225 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|